Top » Catalog » SNPs » Y125026

$18.00

Y125026
[Y125026]

Y125026
hg38 Position: ChrY:14068330..14068330
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y125026_F TTCCCCCAAACAACACCTAC
Reverse Primer: Y125026_R GCCAGTACCACGCTGTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies