Top » Catalog » SNPs » Y158862

$18.00

Y158862
[Y158862]

Y158862
hg38 Position: ChrY:6936643..6936643
Ancestral: G
Derived: A
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y158862_F GATGGTATGGTCAGGTGATATAGGC
Reverse Primer: Y158862_R AGCAGTGACCAGAGGTAACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies