Top » Catalog » SNPs » Y158878

$18.00

Y158878
[Y158878]

Y158878
hg38 Position: ChrY:20390227..20390227
Ancestral: T
Derived: C
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y158878_F TTCAGGGACTGGACACTGC
Reverse Primer: Y158878_R TTTGTGGATTCTTTTACCACTACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies