Top » Catalog » SNPs » Y158910

$18.00

Y158910
[Y158910]

Y158910
hg38 Position: ChrY:17355837..17355837
Ancestral: A
Derived: G
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y158910_F AAGATGAAGAAAAATCAATCAAAATAGC
Reverse Primer: Y158910_R ATTAATGTACTTAAAATATTCTTAAAGCTCATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies