Top » Catalog » SNPs » Y158938

$18.00

Y158938
[Y158938]

Y158938
hg38 Position: ChrY:21289601..21289601
Ancestral: T
Derived: G
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y158938_F TGCTTTATCCCTAGCCCAAAG
Reverse Primer: Y158938_R AGGGAAGTGCTCAGTCCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS714
$9.95
Haplogroup Info
Other products
Currencies