Top » Catalog » SNPs » Y158979

$18.00

Y158979
[Y158979]

Y158979
hg38 Position: ChrY:7682494..7682494
Ancestral: A
Derived: G
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y158979_F GTGAAATTATTGGATCACCATAGAG
Reverse Primer: Y158979_R CTACTTGTAGATTTGTGAAGCCTCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies