Top » Catalog » SNPs » Y159024

$18.00

Y159024
[Y159024]

Y159024
hg38 Position: ChrY:14967703..14967703
Ancestral: C
Derived: T
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: Y159024_F AGGGTAAACACTCTTTAGCTCTCCTG
Reverse Primer: Y159024_R TTCTCTTCAACATAAATTACAGAAAAAACTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies