Top » Catalog » SNPs » A19242

$18.00

A19242
[A19242]

A19242
hg38 Position: ChrY:7960650..7960650
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: E1b1
Comments: Z1057 > CTS5856 > Z5017 > Z5016 > SK888 > S26015 > Z17107
Forward Primer: A19242_F AAGGAAGACTAGTAGGGGAATCAGG
Reverse Primer: A19242_R ACTGGTATTGTTCCAGGGTTATCAC
Reviews

Customers who bought this product also purchased
A19251
A19251
A19250
A19250
A19247
A19247
A19243
A19243
BY4425
BY4425
A19241
A19241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies