Top » Catalog » SNPs » BY4425

$18.00

BY4425
[BY4425]

BY4425
hg38 Position: ChrY:21249003..21249003
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below V13 > S26015
Forward Primer: BY4425_F TGAGCCTCTTTCATGTGCTG
Reverse Primer: BY4425_R TTGACCCCATCAGTCTCTCC
Reviews

Customers who bought this product also purchased
A19241
A19241
A19251
A19251
A19250
A19250
A19247
A19247
A19243
A19243
A19242
A19242
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2025
1 x A2010
1 x A6618
$54.00
Haplogroup Info
Other products
Currencies