Top » Catalog » SNPs » SK1322

$18.00

SK1322
[SK1322]

SK1322
hg38 Position: ChrY:16508295..16508295
Ancestral: C
Derived: T
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1*
Comments: Equal or downstream F3096 Aka S21087
Forward Primer: SK1322_F TGCCTCTATTTTATTGAAGTGGACAC
Reverse Primer: SK1322_R ATCACTGTTCTAGTGAGTTACTCTAAAATGTAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies