Top » Catalog » SNPs » BY57184

$18.00

BY57184
[BY57184]

BY57184
hg38 Position: ChrY:3033319..3033319
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below DF27 > ZZ12 > BY3332 > BY22166 > BY22194
Forward Primer: BY57184_F TTGGGCTAAATCTTGAGAAATTG
Reverse Primer: BY57184_R CCTCTGGCAGCAGACTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies