Top » Catalog » SNPs » BY66046

$18.00

BY66046
[BY66046]

BY66046
hg38 Position: ChrY:7715715..7715715
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below DF27 > ZZ12 > BY3332 > BY22166 > BY22194
Forward Primer: BY66046_F AAGTGATCCTTGGTCTCCCAG
Reverse Primer: BY66046_R GGGCAGCCTGGTATTAATTGTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies