Top » Catalog » SNPs » FGC86596

$18.00

FGC86596
[FGC86596]

FGC86596
hg38 Position: ChrY:21856267..21856267
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: FGC86596_F GCTTTCAAGATCAAAGGGTGTG
Reverse Primer: FGC86596_R TGAAAAACCTCAAACTTTAATGGG
Reviews

Customers who bought this product also purchased
Y82249
Y82249
FGC86593
FGC86593
FGC86592
FGC86592
FGC63180
FGC63180
Y109284
Y109284
E1b David-2 Goodrich Panel
E1b David-2 Goodrich Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies