Top » Catalog » SNPs » FGC57767

$18.00

FGC57767
[FGC57767]

FGC57767
hg38 Position: ChrY:12669907..12669907
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC57767_F GAGGCATTTGTTTACCTCTGG
Reverse Primer: FGC57767_R ATAAGCCTAACACTTATTTTGCACATG
Reviews

Customers who bought this product also purchased
FGC57770
FGC57770
FGC57761
FGC57761
FGC57769
FGC57769
FGC57756
FGC57756
FGC57768
FGC57768
FGC57774
FGC57774
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies