Top » Catalog » SNPs » FGC74115

$18.00

FGC74115
[FGC74115]

FGC74115
hg38 Position: ChrY:9233901..9233901
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC74115_F GAAAAGACATGTCACAGAAAGATTTG
Reverse Primer: FGC74115_R GGATTTGCAGTTTCGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies