Top » Catalog » SNPs » BY187132

$18.00

BY187132
[BY187132]

BY187132
hg38 Position: ChrY:12551124..12551124
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY187132_F GAGTGCAAACCACTATGCTGG
Reverse Primer: BY187132_R TGAGAGGATCAAGGCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies