Top » Catalog » SNPs » FGC12389

$18.00

FGC12389
[FGC12389]

FGC12389
hg38 Position: ChrY:9957855..9957855
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC12389_F CAATCTGTCTTCTGCCTCTCAG
Reverse Primer: FGC12389_R TTCCTCAAAAAAAATCAACACAGTTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies