Top » Catalog » SNPs » FGC12390

$18.00

FGC12390
[FGC12390]

FGC12390
hg38 Position: ChrY:10025166..10025166
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC12390_F ACATCTTCAAAATGTAAAATACATTTTAAAAATG
Reverse Primer: FGC12390_R TAGAACTAAGCAACATGAGGTAACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies