Top » Catalog » SNPs » FGC12397

$18.00

FGC12397
[FGC12397]

FGC12397
hg38 Position: ChrY:13859973..13859973
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC12397_F CAGGCTTGTCTTGAACTCCTG
Reverse Primer: FGC12397_R ACAAGCTCAGGGCCCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies