Top » Catalog » SNPs » FGC12399

$18.00

FGC12399
[FGC12399]

FGC12399
hg38 Position: ChrY:14892090..14892090
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC12399_F GCACTTGCAAATCAGCGTAAC
Reverse Primer: FGC12399_R GCACACAAAGAAAGCTGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies