Top » Catalog » SNPs » FGC10073

$18.00

FGC10073
[FGC10073]

FGC10073
hg38 Position: ChrY:19030880..19030880
Ancestral: T
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10073v2_F CCAGGTTGGAGTGTAGTAATGTGAC
Reverse Primer: FGC10073v2_R ACCATAGCATGCACATGCG
Reviews (1)

Customers who bought this product also purchased
FGC10065
FGC10065
R1b-L371 Group Panel B
R1b-L371 Group Panel B
YFS066633
YFS066633
FGC10052
FGC10052
FGC10062
FGC10062
FGC10083
FGC10083
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies