Top » Catalog » SNPs » FGC10073

$18.00

FGC10073
[FGC10073]

FGC10073
hg38 Position: ChrY:19030880..19030880
Ancestral: T
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10073v2_F CCAGGTTGGAGTGTAGTAATGTGAC
Reverse Primer: FGC10073v2_R ACCATAGCATGCACATGCG
Reviews (1)

Customers who bought this product also purchased
FGC10060
FGC10060
FGC10080
FGC10080
FGC10047
FGC10047
A148
A148
FGC10071
FGC10071
FGC10037
FGC10037
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies