Top » Catalog » SNPs » Y67105

$18.00

Y67105
[Y67105]

Y67105
hg38 Position: ChrY:12586979..12586979
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: R1b
Comments: Below DF104 > S603
Forward Primer: Y67105_F TCTTTTTCAGTGATCCATCAGG
Reverse Primer: Y67105_R GGAAGAAATACGCGATCCAC
Reviews

Customers who bought this product also purchased
FGC57756
FGC57756
FGC57767
FGC57767
FGC57772
FGC57772
R1b Carr Family (Ireland)
R1b Carr Family (Ireland)
FGC57766
FGC57766
FGC57771
FGC57771
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies