Top » Catalog » SNPs » BY155589

$18.00

BY155589
[BY155589]

BY155589
hg38 Position: ChrY:21209130..21209130
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY155589_F GTGCTTTTACCCTGCTGGAG
Reverse Primer: BY155589_R TTGCTGCTATTTGGGTGTTG
Reviews

Customers who bought this product also purchased
Z27131
Z27131
BY50887
BY50887
S26015
S26015
Y110616
Y110616
Z5017
Z5017
BY34282
BY34282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies