Top » Catalog » SNPs » BY155589

$18.00

BY155589
[BY155589]

BY155589
hg38 Position: ChrY:21209130..21209130
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY155589_F GTGCTTTTACCCTGCTGGAG
Reverse Primer: BY155589_R TTGCTGCTATTTGGGTGTTG
Reviews

Customers who bought this product also purchased
BY50887
BY50887
S26015
S26015
Y110616
Y110616
Z5017
Z5017
BY34282
BY34282
E1b-V13 Panel
E1b-V13 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies