Top » Catalog » SNPs » BY50887

$18.00

BY50887
[BY50887]

BY50887
hg38 Position: ChrY:21352948..21352948
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5017 > BY34282
Forward Primer: BY50887_F CTTCATGTTATATGCTAGCAAAATGATG
Reverse Primer: BY50887_R ATTAACAAGAACAGTGATGATAACCTCAG
Reviews

Customers who bought this product also purchased
Y110616
Y110616
Z5017
Z5017
BY34282
BY34282
E1b-V13 Panel
E1b-V13 Panel
Z16988
Z16988
A11837
A11837
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies