Top » Catalog » SNPs » BY50887

$18.00

BY50887
[BY50887]

BY50887
hg38 Position: ChrY:21352948..21352948
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5017 > BY34282
Forward Primer: BY50887_F CTTCATGTTATATGCTAGCAAAATGATG
Reverse Primer: BY50887_R ATTAACAAGAACAGTGATGATAACCTCAG
Reviews

Customers who bought this product also purchased
Z27131
Z27131
BY155589
BY155589
S26015
S26015
Y110616
Y110616
Z5017
Z5017
BY34282
BY34282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies