Top » Catalog » SNPs » PH2358

$18.00

PH2358
[PH2358]

PH2358
hg38 Position: ChrY:14449265..14449265
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: PH2358_F CTCAAAGAGCAGGAGGATGC
Reverse Primer: PH2358_R AGTTTTCCAGGGATTTGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies