Top » Catalog » SNPs » FGC74227

$18.00

FGC74227
[FGC74227]

FGC74227
hg38 Position: ChrY:15469082..15469082
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC74227_F CCGAGTAGCTGGGACTACAGG
Reverse Primer: FGC74227_R TACTTTATTGAATCCATAAATGTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A8458
$18.00
Haplogroup Info
Other products
Currencies