Top » Catalog » SNPs » Y24715

$18.00

Y24715
[Y24715]

Y24715
hg38 Position: ChrY:21198459..21198459
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: A1b1
Comments: Below M13 > Y24401
Forward Primer: Y24715_F GAAAACTATGGGCTATGCAGATG
Reverse Primer: Y24715_R CACACGACGGGACCTGC
Reviews

Customers who bought this product also purchased
DYS617
DYS617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies