Top » Catalog » SNPs » Y28045

$18.00

Y28045
[Y28045]

Y28045
hg38 Position: ChrY:14438656..14438656
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: A1b1
Comments: Below M13 > Y24401 > Y24715
Forward Primer: Y28045_F TGATGTTCACCTTGATTACTCAGTG
Reverse Primer: Y28045_R CCTAATAAAAACATGGAAGGACTAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies