Top » Catalog » SNPs » A23615

$18.00

A23615
[A23615]

A23615
hg38 Position: ChrY:2963021..2963021
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: With BY60222
Forward Primer: A23615_F AAAGGGGGAGTAAGGTGGTG
Reverse Primer: A23615_R CCTGCTACTAAAGACAGAAATAAGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies