Top » Catalog » SNPs » BY154079

$18.00

BY154079
[BY154079]

BY154079
hg38 Position: ChrY:14185999..14185999
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY154079_F AAAGAAAATACGAGTGGCTATATTATTTC
Reverse Primer: BY154079_R AGCCACTGTGCTTGGCC
Reviews

Customers who bought this product also purchased
A23647
A23647
BY152798
BY152798
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies