Top » Catalog » SNPs » FGC30567

$18.00

FGC30567
[FGC30567]

FGC30567
hg38 Position: ChrY:7651693..7651693
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: Below FGC10500 > FGC30566
Forward Primer: FGC30567_F CGATGTCCAGCTGCTGTTG
Reverse Primer: FGC30567_R GTGAGGTACTGGGTTTGTACGTG
Reviews

Customers who bought this product also purchased
DYS442
DYS442
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies