Top » Catalog » SNPs » Y82373

$18.00

Y82373
[Y82373]

Y82373
hg38 Position: ChrY:6840471..6840471
Ancestral: A
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y82373_F AGAATGTATCCCCATCATTAAGTGAAACATGAC
Reverse Primer: Y82373_R TTCAACTAATCCTATTACACAACACAAGTA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies