Top » Catalog » SNPs » A23664

$18.00

A23664
[A23664]

A23664
hg38 Position: ChrY:14472169..14472169
Ancestral: G
Derived: A
Reference: Michael Cooley (2018)
ISOGG Haplogroup: R1b
Comments: Downstream A12020 > A12022
Forward Primer: A23664_F CAAAATAACGGTGGGGCTTC
Reverse Primer: A23664_R GAAGTACGTGCTGGGTCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies