Top » Catalog » SNPs » Y128213

$18.00

Y128213
[Y128213]

Y128213
hg38 Position: ChrY:8955303..8955303
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y128213_F CCTACATACTTAATTACTCAGTGTTTATGTTACC
Reverse Primer: Y128213_R ATTCCCCTGTGGTGACTACAGTC
Reviews

Customers who bought this product also purchased
S2972
S2972
L241
L241
Y129143
Y129143
Z16659
Z16659
A8555
A8555
S2979
S2979
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies