Top » Catalog » SNPs » Y128213

$18.00

Y128213
[Y128213]

Y128213
hg38 Position: ChrY:8955303..8955303
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y128213_F CCTACATACTTAATTACTCAGTGTTTATGTTACC
Reverse Primer: Y128213_R ATTCCCCTGTGGTGACTACAGTC
Reviews

Customers who bought this product also purchased
S2979
S2979
BY5423
BY5423
Z5018
Z5018
A7136
A7136
E1b-V13 Panel
E1b-V13 Panel
S2972
S2972
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies