Top » Catalog » SNPs » FGC86433

$18.00

FGC86433
[FGC86433]

FGC86433
hg38 Position: ChrY:15418060..15418060
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: Below L858 > L829 > PF4878
Forward Primer: FGC86433_F TAGCTTTGAAGATGAGTCAAGAAATGTAG
Reverse Primer: FGC86433_R AGTCTCAACTCACATCAACTATTTATAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies