Top » Catalog » SNPs » Y17455

$18.00

Y17455
[Y17455]

Y17455
hg38 Position: ChrY:26601437..26601437
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: Y17455_F TTTAGGCTCTTGTTACAAATAGCTTAGAAAG
Reverse Primer: Y17455_R GCCATCTTGCCTCCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies