Top » Catalog » SNPs » Y90878

$18.00

Y90878
[Y90878]

Y90878
hg38 Position: ChrY:12149636..12149636
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y90878_F TTAAAACTTCAACTGCCATTTTTG
Reverse Primer: Y90878_R AGTCAGCCCTTGTTTTTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies