Top » Catalog » SNPs » BY8928

$18.00

BY8928
[BY8928]

BY8928
hg38 Position: ChrY:21248603..21248603
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below CTS12227
Forward Primer: BY8928_F ATCTCCTCCAAAGCGTTTCC
Reverse Primer: BY8928_R GAAACTTACAACCTAACTGTCACAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies