Top » Catalog » SNPs » A23660

$18.00

A23660
[A23660]

A23660
hg38 Position: ChrY:15595369..15595369
Ancestral: T
Derived: C
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A23660_F AAAAAAAGGAGAAATAAAAGTATCTCGG
Reverse Primer: A23660_R GGCTGTAGTGCAGTGGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies