Top » Catalog » SNPs » A23679

$18.00

A23679
[A23679]

A23679
hg38 Position: ChrY:12270093..12270093
Ancestral: C
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: FGC5427 > FGC5422 > FGC5419 > FGC5424 > S782 > FGC22257 > FGC22259
Forward Primer: A23679_F TGTTCAATTCCCATCTATAAGAACG
Reverse Primer: A23679_R GTCAGTGTGGTCATTCCTCAAGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies