Top » Catalog » SNPs » Y51673

$18.00

Y51673
[Y51673]

Y51673
hg38 Position: ChrY:14188224..14188224
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y51673_F AAGGGAAAGCAGACATTGGAAG
Reverse Primer: Y51673_R GATTCCATTGGCAAGTAATTCC
Reviews

Customers who bought this product also purchased
Z16983
Z16983
FT277419
FT277419
YP206
YP206
BY131900
BY131900
M223
M223
Y5596
Y5596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies