Top » Catalog » SNPs » Y51673

$18.00

Y51673
[Y51673]

Y51673
hg38 Position: ChrY:14188224..14188224
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y51673_F AAGGGAAAGCAGACATTGGAAG
Reverse Primer: Y51673_R GATTCCATTGGCAAGTAATTCC
Reviews

Customers who bought this product also purchased
BY97555
BY97555
BY111699
BY111699
Y48599
Y48599
FT355524
FT355524
BY125046
BY125046
FT355750
FT355750
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies