Top » Catalog » SNPs » BY183180

$18.00

BY183180
[BY183180]

BY183180
hg38 Position: ChrY:14293051..14293051
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: C
Comments: .
Forward Primer: BY183180_F TTTACAAACACTTACCCCTGTCACC
Reverse Primer: BY183180_R AGTCCAGTTAAACCTCTTTCTTTTGC
Reviews

Customers who bought this product also purchased
M532
M532
M401
M401
FGC16217
FGC16217
M217
M217
F7264
F7264
ZQ31
ZQ31
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies