Top » Catalog » SNPs » BY183180

$18.00

BY183180
[BY183180]

BY183180
hg38 Position: ChrY:14293051..14293051
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: C
Comments: .
Forward Primer: BY183180_F TTTACAAACACTTACCCCTGTCACC
Reverse Primer: BY183180_R AGTCCAGTTAAACCTCTTTCTTTTGC
Reviews

Customers who bought this product also purchased
Y4541
Y4541
SK1076
SK1076
M48
M48
Y4580
Y4580
FGC29011
FGC29011
M532
M532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies