Top » Catalog » SNPs » BY183180

$18.00

BY183180
[BY183180]

BY183180
hg38 Position: ChrY:14293051..14293051
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: C
Comments: .
Forward Primer: BY183180_F TTTACAAACACTTACCCCTGTCACC
Reverse Primer: BY183180_R AGTCCAGTTAAACCTCTTTCTTTTGC
Reviews

Customers who bought this product also purchased
M401
M401
FGC16217
FGC16217
M217
M217
F7264
F7264
ZQ31
ZQ31
C Superclade Panel
C Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies