Top » Catalog » SNPs » YP4647

$18.00

YP4647
[YP4647]

YP4647
hg38 Position: ChrY:7529134..7529134
Ancestral: A
Derived: G
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below L1029
Forward Primer: YP4647_F CTCATGTGAACTTCCAACATGTC
Reverse Primer: YP4647_R GGGAAAACAAAATCATCTTAGATACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies