Top » Catalog » SNPs » ZS8358

$18.00

ZS8358
[ZS8358]

ZS8358
hg38 Position: ChrY:8421044..8421044
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream L93 > ZS1281
Forward Primer: ZS8358_F CCCCAGAAAAAAGTCAATAAGC
Reverse Primer: ZS8358_R CATTCAGGTGGCAATTTTAATTTG
Reviews

Customers who bought this product also purchased
A24502
A24502
A24504
A24504
A24498
A24498
ZS1324
ZS1324
ZS8360
ZS8360
Y153041
Y153041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies